Transcript: Mouse XM_006532114.3

PREDICTED: Mus musculus CDC like kinase 4 (Clk4), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Clk4 (12750)
Length:
1921
CDS:
669..1574

Additional Resources:

NCBI RefSeq record:
XM_006532114.3
NBCI Gene record:
Clk4 (12750)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532114.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023195 GCAAGCCGTTAAAGGAATTTA pLKO.1 1420 CDS 100% 15.000 21.000 N Clk4 n/a
2 TRCN0000361103 GACGAACATCATAGTACTTTG pLKO_005 1119 CDS 100% 10.800 15.120 N Clk4 n/a
3 TRCN0000361162 TTACCATAGAGACGTTGAAAG pLKO_005 483 5UTR 100% 10.800 15.120 N Clk4 n/a
4 TRCN0000361108 TACCGGATCCATTGCAGTAAA pLKO_005 508 5UTR 100% 0.000 0.000 N Clk4 n/a
5 TRCN0000361109 ATCGGGACCGGAGATACATTG pLKO_005 419 5UTR 100% 10.800 8.640 N Clk4 n/a
6 TRCN0000229539 AGACGCTGCAAGCCGTTAAAG pLKO_005 1413 CDS 100% 13.200 9.240 N Clk4 n/a
7 TRCN0000219100 AGACTGTGTCAGTCAACTAAA pLKO_005 1623 3UTR 100% 13.200 9.240 N Clk4 n/a
8 TRCN0000361159 ATAGCATAACTACCTTGTTAA pLKO_005 1714 3UTR 100% 13.200 9.240 N Clk4 n/a
9 TRCN0000361105 CCCTAAGAGAAAGCGTAATAG pLKO_005 555 5UTR 100% 13.200 9.240 N Clk4 n/a
10 TRCN0000023196 CCGGAGATACATTGATGAATA pLKO.1 426 5UTR 100% 13.200 9.240 N Clk4 n/a
11 TRCN0000361102 GACAAGGAAACGCAAGTATTT pLKO_005 1337 CDS 100% 13.200 9.240 N Clk4 n/a
12 TRCN0000023194 GCCCTAAGAGAAAGCGTAATA pLKO.1 554 5UTR 100% 13.200 9.240 N Clk4 n/a
13 TRCN0000361161 TTTGACCTGGTTCGAAGAATG pLKO_005 1473 CDS 100% 10.800 7.560 N Clk4 n/a
14 TRCN0000023197 GCCATTTCAAATTGATCACAT pLKO.1 896 CDS 100% 4.950 3.465 N Clk4 n/a
15 TRCN0000218637 AGTCTGACTATGTAGTCAAAT pLKO_005 1015 CDS 100% 1.320 0.924 N Clk4 n/a
16 TRCN0000023198 CCCAGCACATATGATCCAGAA pLKO.1 1316 CDS 100% 0.000 0.000 N Clk4 n/a
17 TRCN0000229538 TCGTTCTGAAATCCAAGTATT pLKO_005 731 CDS 100% 13.200 7.920 N Clk4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532114.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489812 TTTTGATATCCTAGGTATCTTGGG pLX_317 28.3% 56.6% 61.4% V5 (many diffs) n/a
2 TRCN0000491429 CTCCCGTCGCCGTGCATTGGACCA pLX_317 26.6% 56.6% 61.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000487864 TCCAGGACTTCTACTATTCCGACA pLX_317 22.2% 56.5% 61.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV