Transcript: Mouse XM_006532325.3

PREDICTED: Mus musculus kinesin family member 3A (Kif3a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kif3a (16568)
Length:
5701
CDS:
335..2512

Additional Resources:

NCBI RefSeq record:
XM_006532325.3
NBCI Gene record:
Kif3a (16568)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532325.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339513 CTACCCTGGGCAACGTTATTT pLKO_005 1167 CDS 100% 15.000 21.000 N Kif3a n/a
2 TRCN0000339510 TTCCGTTGTTGTACGTGAATG pLKO_005 2766 3UTR 100% 10.800 15.120 N Kif3a n/a
3 TRCN0000090404 CGCCATCTTTACAATTACTAT pLKO.1 997 CDS 100% 5.625 7.875 N Kif3a n/a
4 TRCN0000090407 TCCGCCAGTTTCAGAAAGAAA pLKO.1 1413 CDS 100% 5.625 4.500 N Kif3a n/a
5 TRCN0000090405 GCGAAGAAAGCGTTCTGCAAA pLKO.1 2458 CDS 100% 4.950 3.960 N Kif3a n/a
6 TRCN0000339512 ATATTGGGCCAGCAGATTATA pLKO_005 1296 CDS 100% 15.000 10.500 N Kif3a n/a
7 TRCN0000339511 GGCCTGATGTGGGAGTATATA pLKO_005 855 CDS 100% 15.000 10.500 N Kif3a n/a
8 TRCN0000339514 TTAACTGCAAGACCAATTATT pLKO_005 569 CDS 100% 15.000 10.500 N Kif3a n/a
9 TRCN0000090403 CCCTGGACATACAGCTTACAA pLKO.1 3242 3UTR 100% 5.625 3.938 N Kif3a n/a
10 TRCN0000090406 CCAAAGACATTTACTTTCGAT pLKO.1 506 CDS 100% 3.000 2.100 N Kif3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532325.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14061 pDONR223 100% 84.7% 93.8% None (many diffs) n/a
2 ccsbBroad304_14061 pLX_304 0% 84.7% 93.8% V5 (many diffs) n/a
3 TRCN0000478731 ATGAAATGAAAACGAACCGCTTCC pLX_317 14.9% 84.7% 93.8% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV