Transcript: Mouse XM_006532445.3

PREDICTED: Mus musculus N-myristoyltransferase 1 (Nmt1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nmt1 (18107)
Length:
1967
CDS:
134..1624

Additional Resources:

NCBI RefSeq record:
XM_006532445.3
NBCI Gene record:
Nmt1 (18107)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532445.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055163 CCAGCGAACTTGACAATTATA pLKO.1 1763 3UTR 100% 15.000 10.500 N Nmt1 n/a
2 TRCN0000301583 CCAGCGAACTTGACAATTATA pLKO_005 1763 3UTR 100% 15.000 10.500 N Nmt1 n/a
3 TRCN0000055165 CCAGCAAACATCCACATCTAT pLKO.1 821 CDS 100% 5.625 3.938 N Nmt1 n/a
4 TRCN0000055166 CCAACCCACAAGAGTCTGAAA pLKO.1 1364 CDS 100% 4.950 3.465 N Nmt1 n/a
5 TRCN0000301584 CCAACCCACAAGAGTCTGAAA pLKO_005 1364 CDS 100% 4.950 3.465 N Nmt1 n/a
6 TRCN0000055167 CAGGAAATACAGAAGGCCATT pLKO.1 401 CDS 100% 4.050 2.835 N Nmt1 n/a
7 TRCN0000301517 CAGGAAATACAGAAGGCCATT pLKO_005 401 CDS 100% 4.050 2.835 N Nmt1 n/a
8 TRCN0000055164 CCACTGATGATGGAAGGGAAT pLKO.1 182 CDS 100% 4.050 2.835 N Nmt1 n/a
9 TRCN0000331742 CCACTGATGATGGAAGGGAAT pLKO_005 182 CDS 100% 4.050 2.835 N Nmt1 n/a
10 TRCN0000035711 CCAGGAAATACAGAAGGCCAT pLKO.1 400 CDS 100% 2.160 1.512 N NMT1 n/a
11 TRCN0000289870 CCAGGAAATACAGAAGGCCAT pLKO_005 400 CDS 100% 2.160 1.512 N NMT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532445.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01102 pDONR223 100% 90.9% 97.3% None (many diffs) n/a
2 ccsbBroad304_01102 pLX_304 0% 90.9% 97.3% V5 (many diffs) n/a
3 TRCN0000480574 GTGTTGCATTATTGCGTATGTCGG pLX_317 27.5% 90.9% 97.3% V5 (many diffs) n/a
Download CSV