Transcript: Mouse XM_006532665.3

PREDICTED: Mus musculus elongation factor Tu GTP binding domain containing 2 (Eftud2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Eftud2 (20624)
Length:
3371
CDS:
138..3047

Additional Resources:

NCBI RefSeq record:
XM_006532665.3
NBCI Gene record:
Eftud2 (20624)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532665.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294566 CAGGATGTTGTGCTCAATTAT pLKO_005 3018 CDS 100% 15.000 10.500 N Eftud2 n/a
2 TRCN0000123642 CCTGTTTCGTAGATTGTTTAA pLKO.1 556 CDS 100% 13.200 9.240 N Eftud2 n/a
3 TRCN0000306704 CCTGTTTCGTAGATTGTTTAA pLKO_005 556 CDS 100% 13.200 9.240 N Eftud2 n/a
4 TRCN0000294567 TGAGCATCGGGAACTGCTATG pLKO_005 3107 3UTR 100% 6.000 4.200 N Eftud2 n/a
5 TRCN0000123641 CCCATTATAAAGCCAGTGAAA pLKO.1 402 CDS 100% 4.950 3.465 N Eftud2 n/a
6 TRCN0000287153 CCCATTATAAAGCCAGTGAAA pLKO_005 402 CDS 100% 4.950 3.465 N Eftud2 n/a
7 TRCN0000123640 CGCAAGGTCAACAAGAGCTAT pLKO.1 1950 CDS 100% 4.950 3.465 N Eftud2 n/a
8 TRCN0000287154 CGCAAGGTCAACAAGAGCTAT pLKO_005 1950 CDS 100% 4.950 3.465 N Eftud2 n/a
9 TRCN0000123639 CCTGGTTTCTTCTGTGGCCTT pLKO.1 3181 3UTR 100% 2.160 1.512 N Eftud2 n/a
10 TRCN0000123643 GCAGATTGTGTGTCTGCTGTT pLKO.1 2646 CDS 100% 0.405 0.284 N Eftud2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532665.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07395 pDONR223 100% 91.2% 99% None (many diffs) n/a
2 ccsbBroad304_07395 pLX_304 0% 91.2% 99% V5 (many diffs) n/a
3 TRCN0000478794 TCTCAACTAACGGTCAGCTGGAAC pLX_317 12.3% 91.2% 99% V5 (many diffs) n/a
Download CSV