Transcript: Mouse XM_006532722.1

PREDICTED: Mus musculus signal transducer and activator of transcription 5A (Stat5a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stat5a (20850)
Length:
3733
CDS:
179..2560

Additional Resources:

NCBI RefSeq record:
XM_006532722.1
NBCI Gene record:
Stat5a (20850)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532722.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231566 GCCATTCACGACGCGAGATTT pLKO_005 2110 CDS 100% 13.200 18.480 N Stat5a n/a
2 TRCN0000012550 CGCCAGATGCAAGTGTTGTAT pLKO.1 224 CDS 100% 5.625 7.875 N Stat5a n/a
3 TRCN0000012548 GAACCTATCATTGCTGACAAA pLKO.1 2763 3UTR 100% 4.950 6.930 N Stat5a n/a
4 TRCN0000012552 CAAGTGTTGTATGGGCAGCAT pLKO.1 233 CDS 100% 2.640 2.112 N Stat5a n/a
5 TRCN0000231567 CGAGGTCTTTGCCAAGTATTA pLKO_005 2206 CDS 100% 13.200 9.240 N Stat5a n/a
6 TRCN0000257383 GACGTGAGATTCAAGTCTAAC pLKO_005 3086 3UTR 100% 10.800 7.560 N Stat5a n/a
7 TRCN0000231568 TGGTCCCTGAGTTCGTCAATG pLKO_005 2283 CDS 100% 10.800 7.560 N Stat5a n/a
8 TRCN0000231569 TTGACCAAGATGGCGAGTTTG pLKO_005 2412 CDS 100% 10.800 7.560 N Stat5a n/a
9 TRCN0000222114 GAGAAGTTCACAGTCCTGTTT pLKO.1 1490 CDS 100% 4.950 3.465 N STAT5A n/a
10 TRCN0000012551 CCTCTGGAATCTGAAGCCATT pLKO.1 2095 CDS 100% 4.050 2.835 N Stat5a n/a
11 TRCN0000012549 GCCAAGTATTACACTCCTGTA pLKO.1 2216 CDS 100% 4.050 2.835 N Stat5a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532722.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07008 pDONR223 100% 90.4% 96.3% None (many diffs) n/a
2 ccsbBroad304_07008 pLX_304 0% 90.4% 96.3% V5 (many diffs) n/a
3 TRCN0000473086 GCAGCTAGCTCAGGACTTTAACCG pLX_317 15% 90.4% 96.3% V5 (many diffs) n/a
4 ccsbBroadEn_11162 pDONR223 100% 44.1% 46.1% None (many diffs) n/a
5 ccsbBroad304_11162 pLX_304 0% 44.1% 46.1% V5 (many diffs) n/a
6 TRCN0000473930 GGACCACCCACTCAATCTATTGCG pLX_317 45.4% 44.1% 46.1% V5 (many diffs) n/a
Download CSV