Transcript: Mouse XM_006532916.2

PREDICTED: Mus musculus solute carrier family 16 (monocarboxylic acid transporters), member 11 (Slc16a11), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc16a11 (216867)
Length:
1860
CDS:
470..1813

Additional Resources:

NCBI RefSeq record:
XM_006532916.2
NBCI Gene record:
Slc16a11 (216867)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532916.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079691 CGCATGCTTTAGATCAAGGCA pLKO.1 1197 CDS 100% 0.750 1.050 N Slc16a11 n/a
2 TRCN0000079690 GCATGCTTTAGATCAAGGCAT pLKO.1 1198 CDS 100% 2.640 2.112 N Slc16a11 n/a
3 TRCN0000079689 CCTTGCAGTTCCTCCTTGATA pLKO.1 945 CDS 100% 5.625 3.938 N Slc16a11 n/a
4 TRCN0000079692 TGGCTTGGTCTTCTCGGCTTT pLKO.1 748 CDS 100% 4.050 2.835 N Slc16a11 n/a
5 TRCN0000444714 AGGGCTGGTGATGATGCTGAT pLKO_005 1528 CDS 100% 4.050 2.430 N SLC16A11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532916.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09742 pDONR223 100% 79.9% 83% None (many diffs) n/a
2 ccsbBroad304_09742 pLX_304 0% 79.9% 83% V5 (many diffs) n/a
3 TRCN0000478116 TATCCCGGCGCAAAGTCCCTTGCA pLX_317 12% 79.9% 83% V5 (many diffs) n/a
Download CSV