Construct: ORF TRCN0000478116
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008278.1_s317c1
- Derived from:
- ccsbBroadEn_09742
- DNA Barcode:
- TATCCCGGCGCAAAGTCCCTTGCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SLC16A11 (162515)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478116
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 162515 | SLC16A11 | solute carrier family 16 me... | NM_001370549.1 | 94.8% | 94.9% | 0_1ins72;207C>T |
| 2 | human | 162515 | SLC16A11 | solute carrier family 16 me... | NM_153357.3 | 94.8% | 94.9% | 0_1ins72;207C>T |
| 3 | human | 162515 | SLC16A11 | solute carrier family 16 me... | NM_001370553.1 | 80.8% | 79.8% | (many diffs) |
| 4 | human | 162515 | SLC16A11 | solute carrier family 16 me... | XM_017024282.2 | 36.8% | 34.5% | (many diffs) |
| 5 | mouse | 216867 | Slc16a11 | solute carrier family 16 (m... | NM_153081.3 | 79.9% | 83% | (many diffs) |
| 6 | mouse | 216867 | Slc16a11 | solute carrier family 16 (m... | XM_006532916.2 | 79.9% | 83% | (many diffs) |
| 7 | mouse | 216867 | Slc16a11 | solute carrier family 16 (m... | XM_011248924.2 | 79.9% | 83% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1482
- ORF length:
- 1413
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gccagctccc cagcggaagc acaggcgtgg aggcttctct cacagatgtt 121 tccccacccc gcagacggcg atgacccccc agcccgccgg acccccggat gggggctggg 181 gctgggtggt ggcggccgca gccttcgcga taaacgggct gtcctacggg ctgctgcgct 241 cgctgggcct tgccttccct gaccttgccg agcactttga ccgaagcgcc caggacactg 301 cgtggatcag cgccctggcc ctggccgtgc agcaggcagc cagccctgtg ggcagcgccc 361 tgagcacgcg ctggggggcc cgccccgtgg tgatggttgg gggcgtcctc gcctcgctgg 421 gcttcgtctt ctcggctttc gccagcgatc tgctgcatct ctacctcggc ctgggcctcc 481 tcgctggctt tggttgggcc ctggtgttcg cccccgccct aggcaccctc tcgcgttact 541 tctcccgccg tcgagtcttg gcggtggggc tggcgctcac cggcaacggg gcctcctcgc 601 tgctcctggc gcccgccttg cagcttcttc tcgatacttt cggctggcgg ggcgctctgc 661 tcctcctcgg cgcgatcacc ctccacctca ccccctgtgg cgccctgctg ctacccctgg 721 tccttcctgg agacccccca gccccaccgc gtagtcccct agctgccctc ggcctgagtc 781 tgttcacacg ccgggccttc tcaatctttg ctctaggcac agccctggtt gggggcgggt 841 acttcgttcc ttacgtgcac ttggctcccc acgctttaga ccggggcctg gggggatacg 901 gagcagcgct ggtggtggcc gtggctgcga tgggggatgc gggcgcccgg ctggtctgcg 961 ggtggctggc agaccaaggc tgggtgcccc tcccgcggct gctggccgta ttcggggctc 1021 tgactgggct ggggctgtgg gtggtggggc tggtgcccgt ggtgggcggc gaagagagct 1081 gggggggtcc cctgctggcc gcggctgtgg cctatgggct gagcgcgggg agttacgccc 1141 cgctggtttt cggtgtactc cccgggctgg tgggcgtcgg aggtgtggtg caggccacag 1201 ggctggtgat gatgctgatg agcctcgggg ggctcctggg ccctcccctg tcaggcttcc 1261 taagggatga gacaggagac ttcaccgcct ctttcctcct gtctggttct ttgatcctcT 1321 CCGGCAGCTT CATCTACATA GGGTTGCCCA GGGCGCTGCC CTCCTGTGGT CCAGCCTCCC 1381 CTCCAGCCAC GCCTCCCCCA GAGACGGGGG AGCTGCTTCC CGCTCCCCAG GCAGTCTTGC 1441 TGTCCCCAGG AGGCCCTGGC TCCACTCTGG ACACCACTTG TTTGCCAACT TTCTTGTACA 1501 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1561 AATGAACTAG CCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1621 AGGACGATAT CCCGGCGCAA AGTCCCTTGC AACGCGTTAA GTCgacaatc aacctctgga 1681 ttacaaaatt tgtgaaagat t