Transcript: Mouse XM_006532931.3

PREDICTED: Mus musculus WSC domain containing 1 (Wscd1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wscd1 (216881)
Length:
2953
CDS:
607..2325

Additional Resources:

NCBI RefSeq record:
XM_006532931.3
NBCI Gene record:
Wscd1 (216881)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532931.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176180 GCTTTGCACACACAGACAAAT pLKO.1 2640 3UTR 100% 13.200 9.240 N Wscd1 n/a
2 TRCN0000193115 CCATTCTCACAGTGACCATTT pLKO.1 2575 3UTR 100% 10.800 7.560 N Wscd1 n/a
3 TRCN0000193909 CCGGAGTTTGTGAATAGCTAT pLKO.1 1978 CDS 100% 4.950 3.465 N Wscd1 n/a
4 TRCN0000173274 CAGAACACAGTTCCTGCTACT pLKO.1 645 CDS 100% 4.050 2.835 N Wscd1 n/a
5 TRCN0000173334 GAACAACAAAGAGGGCAGCTT pLKO.1 2160 CDS 100% 2.640 1.848 N Wscd1 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2672 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532931.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07864 pDONR223 100% 81.7% 85.2% None (many diffs) n/a
2 ccsbBroad304_07864 pLX_304 0% 81.7% 85.2% V5 (many diffs) n/a
3 TRCN0000477477 TCTCTCGCAAATTAAACTGCAGCC pLX_317 22.6% 81.7% 85.2% V5 (many diffs) n/a
Download CSV