Transcript: Mouse XM_006533050.2

PREDICTED: Mus musculus cell division cycle 27 (Cdc27), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdc27 (217232)
Length:
5487
CDS:
134..2629

Additional Resources:

NCBI RefSeq record:
XM_006533050.2
NBCI Gene record:
Cdc27 (217232)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533050.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248355 CCAGATTGGACGGGCTTATTT pLKO_005 1663 CDS 100% 15.000 21.000 N Cdc27 n/a
2 TRCN0000248359 CGCTTACGCCTATACTCTATT pLKO_005 1954 CDS 100% 13.200 18.480 N Cdc27 n/a
3 TRCN0000248358 CTTCGTGGAAATGGTTATTAT pLKO_005 4975 3UTR 100% 15.000 12.000 N Cdc27 n/a
4 TRCN0000248357 GACCTGGTACTGCCATATTAT pLKO_005 876 CDS 100% 15.000 12.000 N Cdc27 n/a
5 TRCN0000142701 CCAGATCCTGACCAAACATTT pLKO.1 617 CDS 100% 13.200 10.560 N CDC27 n/a
6 TRCN0000275428 CCAGATCCTGACCAAACATTT pLKO_005 617 CDS 100% 13.200 10.560 N CDC27 n/a
7 TRCN0000248356 GAGCATGATATAGCAATTAAA pLKO_005 1898 CDS 100% 15.000 10.500 N Cdc27 n/a
8 TRCN0000285364 GATGAGCCTTCTTCGTGAAAT pLKO_005 1540 CDS 100% 13.200 9.240 N CDC27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533050.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05973 pDONR223 100% 92.7% 96.7% None (many diffs) n/a
2 ccsbBroad304_05973 pLX_304 0% 92.7% 96.7% V5 (many diffs) n/a
3 TRCN0000479954 TGTATTTACTAAAAAATATTCCCA pLX_317 14% 92.7% 96.7% V5 (many diffs) n/a
Download CSV