Transcript: Mouse XM_006533303.2

PREDICTED: Mus musculus mediator complex subunit 24 (Med24), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Med24 (23989)
Length:
3494
CDS:
169..3189

Additional Resources:

NCBI RefSeq record:
XM_006533303.2
NBCI Gene record:
Med24 (23989)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533303.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099322 CGTACCTGAAGTACGCCATTA pLKO.1 353 CDS 100% 1.080 1.512 N Med24 n/a
2 TRCN0000332281 CGTACCTGAAGTACGCCATTA pLKO_005 353 CDS 100% 1.080 1.512 N Med24 n/a
3 TRCN0000099324 GAACTCAATCTTGGAACACAT pLKO.1 2217 CDS 100% 4.950 3.960 N Med24 n/a
4 TRCN0000332202 GAACTCAATCTTGGAACACAT pLKO_005 2217 CDS 100% 4.950 3.960 N Med24 n/a
5 TRCN0000099323 CATAGAGCATTCTCTTCTAAA pLKO.1 798 CDS 100% 13.200 9.240 N Med24 n/a
6 TRCN0000217980 TTCTGCAACAACCTGATTAAG pLKO_005 2449 CDS 100% 13.200 9.240 N MED24 n/a
7 TRCN0000019651 CCAATGGGCAATCAACATGAA pLKO.1 231 CDS 100% 4.950 3.465 N MED24 n/a
8 TRCN0000099321 GCCATAGAGCATTCTCTTCTA pLKO.1 796 CDS 100% 4.950 3.465 N Med24 n/a
9 TRCN0000332280 GCCATAGAGCATTCTCTTCTA pLKO_005 796 CDS 100% 4.950 3.465 N Med24 n/a
10 TRCN0000099320 CCCTGACTCATCATGGCCCTA pLKO.1 3270 3UTR 100% 0.720 0.504 N Med24 n/a
11 TRCN0000332201 CCCTGACTCATCATGGCCCTA pLKO_005 3270 3UTR 100% 0.720 0.504 N Med24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533303.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07499 pDONR223 100% 87% 92.4% None (many diffs) n/a
2 ccsbBroad304_07499 pLX_304 0% 87% 92.4% V5 (many diffs) n/a
3 TRCN0000466728 GATGGCTTTCTTTAACAGGCGAGC pLX_317 10.8% 87% 92.4% V5 (many diffs) n/a
Download CSV