Transcript: Mouse XM_006533370.3

PREDICTED: Mus musculus mitogen-activated protein kinase kinase 4 (Map2k4), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Map2k4 (26398)
Length:
4760
CDS:
1492..2337

Additional Resources:

NCBI RefSeq record:
XM_006533370.3
NBCI Gene record:
Map2k4 (26398)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533370.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197078 GATGTAGTAATGCGGAGTAGT pLKO.1 1585 CDS 100% 4.950 6.930 N MAP2K4 n/a
2 TRCN0000010495 CAACTTGTGCCTTACGAAGGA pLKO.1 2169 CDS 100% 2.640 3.696 N MAP2K4 n/a
3 TRCN0000025268 GCATCAAGACAAGGGTATGAT pLKO.1 1972 CDS 100% 5.625 4.500 N Map2k4 n/a
4 TRCN0000345131 GCATCAAGACAAGGGTATGAT pLKO_005 1972 CDS 100% 5.625 4.500 N Map2k4 n/a
5 TRCN0000025266 CCCATACATTGTTCAGTTCTA pLKO.1 1611 CDS 100% 4.950 3.960 N Map2k4 n/a
6 TRCN0000353171 CCCATACATTGTTCAGTTCTA pLKO_005 1611 CDS 100% 4.950 3.960 N Map2k4 n/a
7 TRCN0000025267 CTTCTGAAACATCCCTTTATT pLKO.1 2218 CDS 100% 15.000 10.500 N Map2k4 n/a
8 TRCN0000345139 CTTCTGAAACATCCCTTTATT pLKO_005 2218 CDS 100% 15.000 10.500 N Map2k4 n/a
9 TRCN0000039914 CCAAAGTGGAATAGTGTATTT pLKO.1 2059 CDS 100% 13.200 9.240 N MAP2K4 n/a
10 TRCN0000196996 GACAGCTTGTGGACTCTATTG pLKO.1 1892 CDS 100% 10.800 7.560 N MAP2K4 n/a
11 TRCN0000010496 TACATTGTGAGCTCTGGTTAT pLKO.1 4411 3UTR 100% 10.800 7.560 N MAP2K4 n/a
12 TRCN0000025265 CCGGAAGAGATCTTAGGCAAA pLKO.1 1738 CDS 100% 4.050 2.835 N Map2k4 n/a
13 TRCN0000345130 CCGGAAGAGATCTTAGGCAAA pLKO_005 1738 CDS 100% 4.050 2.835 N Map2k4 n/a
14 TRCN0000001392 ACGAGGAGCTTATGGTTCTGT pLKO.1 1464 5UTR 100% 3.000 2.100 N MAP2K4 n/a
15 TRCN0000039913 ACATTGTGAGCTCTGGTTATC pLKO.1 4412 3UTR 100% 10.800 7.560 N MAP2K4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533370.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489440 AAACTTTGGGGGACTTTCACTCAG pLX_317 26.9% 67.5% 70.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV