Transcript: Mouse XM_006533377.3

PREDICTED: Mus musculus mitogen-activated protein kinase kinase 6 (Map2k6), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Map2k6 (26399)
Length:
4765
CDS:
633..1430

Additional Resources:

NCBI RefSeq record:
XM_006533377.3
NBCI Gene record:
Map2k6 (26399)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533377.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025260 CCGCGGACTTTGTTGACTTTA pLKO.1 1276 CDS 100% 13.200 18.480 N Map2k6 n/a
2 TRCN0000278600 CCGCGGACTTTGTTGACTTTA pLKO_005 1276 CDS 100% 13.200 18.480 N Map2k6 n/a
3 TRCN0000025262 GCCACAGTTAATAGCCAGGAA pLKO.1 681 CDS 100% 2.640 2.112 N Map2k6 n/a
4 TRCN0000278599 GCCACAGTTAATAGCCAGGAA pLKO_005 681 CDS 100% 2.640 2.112 N Map2k6 n/a
5 TRCN0000025259 GCCCACATATCCAGAGCTTAT pLKO.1 1331 CDS 100% 10.800 7.560 N Map2k6 n/a
6 TRCN0000278598 GCCCACATATCCAGAGCTTAT pLKO_005 1331 CDS 100% 10.800 7.560 N Map2k6 n/a
7 TRCN0000025261 GCCAAACAATTCCAGAGGATA pLKO.1 865 CDS 100% 4.950 3.465 N Map2k6 n/a
8 TRCN0000278708 GCCAAACAATTCCAGAGGATA pLKO_005 865 CDS 100% 4.950 3.465 N Map2k6 n/a
9 TRCN0000025263 GCCTTCTAATGTGCTCATTAA pLKO.1 968 CDS 100% 1.320 0.924 N Map2k6 n/a
10 TRCN0000297507 GCCTTCTAATGTGCTCATTAA pLKO_005 968 CDS 100% 1.320 0.924 N Map2k6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533377.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01291 pDONR223 100% 71.5% 77.5% None (many diffs) n/a
2 ccsbBroad304_01291 pLX_304 0% 71.5% 77.5% V5 (many diffs) n/a
3 TRCN0000472398 TATATCCATGATGTCTATAAATAT pLX_317 37.8% 71.5% 77.5% V5 (many diffs) n/a
4 ccsbBroadEn_14810 pDONR223 0% 71.5% 77.5% None (many diffs) n/a
5 ccsbBroad304_14810 pLX_304 0% 71.5% 77.5% V5 (many diffs) n/a
6 TRCN0000467778 GAACAGTGCGAGCGACACCTGAGA pLX_317 34.2% 71.5% 77.5% V5 (many diffs) n/a
7 TRCN0000492175 CACTGTTGATGCCTACAGTTGAGT pLX_317 34.2% 71.3% 77.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV