Transcript: Mouse XM_006533436.1

PREDICTED: Mus musculus myosin phosphatase Rho interacting protein (Mprip), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mprip (26936)
Length:
14368
CDS:
3077..9100

Additional Resources:

NCBI RefSeq record:
XM_006533436.1
NBCI Gene record:
Mprip (26936)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533436.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091173 GCACACTCACTGTCAGTATTA pLKO.1 9383 3UTR 100% 13.200 9.240 N Mprip n/a
2 TRCN0000318288 GCACACTCACTGTCAGTATTA pLKO_005 9383 3UTR 100% 13.200 9.240 N Mprip n/a
3 TRCN0000091175 GCTGACCTAGATGGAGAAATT pLKO.1 3458 CDS 100% 13.200 9.240 N Mprip n/a
4 TRCN0000318287 GCTGACCTAGATGGAGAAATT pLKO_005 3458 CDS 100% 13.200 9.240 N Mprip n/a
5 TRCN0000091176 GCCACCATATCAGCCATTGAA pLKO.1 8282 CDS 100% 5.625 3.938 N Mprip n/a
6 TRCN0000091177 GCCTGAGATACTACAGGGATT pLKO.1 3420 CDS 100% 4.050 2.835 N Mprip n/a
7 TRCN0000318286 GCCTGAGATACTACAGGGATT pLKO_005 3420 CDS 100% 4.050 2.835 N Mprip n/a
8 TRCN0000048650 GCTCTTTGAATCCAGGGACTT pLKO.1 9067 CDS 100% 4.050 2.430 N MPRIP n/a
9 TRCN0000307725 GCTCTTTGAATCCAGGGACTT pLKO_005 9067 CDS 100% 4.050 2.430 N MPRIP n/a
10 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 11534 3UTR 100% 4.050 2.025 Y Mtif2 n/a
11 TRCN0000372928 AGGATGAACTCCAGACAGCTG pLKO_005 8754 CDS 100% 2.160 1.512 N MLN n/a
12 TRCN0000088533 CGGGAGGCAGAGGCAGGCAAT pLKO.1 11554 3UTR 100% 0.000 0.000 Y Trrap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533436.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.