Transcript: Mouse XM_006533539.3

PREDICTED: Mus musculus follistatin-like 4 (Fstl4), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fstl4 (320027)
Length:
8871
CDS:
1970..3364

Additional Resources:

NCBI RefSeq record:
XM_006533539.3
NBCI Gene record:
Fstl4 (320027)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533539.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113613 CCTGCGATTTGATGACTATAA pLKO.1 1505 5UTR 100% 13.200 18.480 N Fstl4 n/a
2 TRCN0000113612 CCAGACGCTATACGACCTAAA pLKO.1 3001 CDS 100% 10.800 15.120 N Fstl4 n/a
3 TRCN0000113614 GCCAACAAATCTCATCATCAA pLKO.1 2632 CDS 100% 4.950 3.465 N Fstl4 n/a
4 TRCN0000113611 GCCCAGAATCATTTGGCTGAA pLKO.1 1942 5UTR 100% 4.050 2.835 N Fstl4 n/a
5 TRCN0000113610 GCAACCAAGATTGGGTGGTTT pLKO.1 3565 3UTR 100% 0.495 0.347 N Fstl4 n/a
6 TRCN0000178741 CACACACATACACACACACAA pLKO.1 5243 3UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533539.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11677 pDONR223 100% 23.6% 24.3% None (many diffs) n/a
2 ccsbBroad304_11677 pLX_304 0% 23.6% 24.3% V5 (many diffs) n/a
3 TRCN0000479880 ACATTTGGACCATGCGTCAATGCC pLX_317 19.2% 23.6% 24.3% V5 (many diffs) n/a
Download CSV