Transcript: Mouse XM_006534018.2

PREDICTED: Mus musculus phosphoribosyl pyrophosphate synthetase-associated protein 1 (Prpsap1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prpsap1 (67763)
Length:
1826
CDS:
231..1280

Additional Resources:

NCBI RefSeq record:
XM_006534018.2
NBCI Gene record:
Prpsap1 (67763)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534018.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079116 CTTCAGTATATCCAGGAAGAA pLKO.1 681 CDS 100% 4.950 3.465 N Prpsap1 n/a
2 TRCN0000079113 GCTGGTAACACCTTCCAGTAA pLKO.1 1453 3UTR 100% 4.950 3.465 N Prpsap1 n/a
3 TRCN0000079115 GTTGTATATCAGGAGACCAAT pLKO.1 321 CDS 100% 4.950 3.465 N Prpsap1 n/a
4 TRCN0000079114 CCTGATTCTTTCTGAGGCGAT pLKO.1 1196 CDS 100% 2.160 1.512 N Prpsap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534018.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11060 pDONR223 100% 86.6% 90.8% None (many diffs) n/a
2 ccsbBroad304_11060 pLX_304 0% 86.6% 90.8% V5 (many diffs) n/a
3 TRCN0000466777 GTCTGTCAGTTTCCAATATTTCTT pLX_317 38.9% 86.6% 90.8% V5 (many diffs) n/a
Download CSV