Transcript: Mouse XM_006534063.3

PREDICTED: Mus musculus nuclear fragile X mental retardation protein interacting protein 2 (Nufip2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nufip2 (68564)
Length:
4015
CDS:
1518..3116

Additional Resources:

NCBI RefSeq record:
XM_006534063.3
NBCI Gene record:
Nufip2 (68564)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534063.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201293 GAATGCGAGTAGATGGTTCAA pLKO.1 1846 CDS 100% 4.950 6.930 N Nufip2 n/a
2 TRCN0000241120 CAAGTAGTTCAGGCTATATTA pLKO_005 1615 CDS 100% 15.000 10.500 N Nufip2 n/a
3 TRCN0000191977 GCAGCCGTTGAACAAATTAAA pLKO.1 2418 CDS 100% 15.000 10.500 N Nufip2 n/a
4 TRCN0000241119 TGAAGCTACCAACCCTATTTC pLKO_005 1382 5UTR 100% 13.200 9.240 N Nufip2 n/a
5 TRCN0000241122 TGGATCTGAGAGTGGATATAC pLKO_005 1676 CDS 100% 13.200 9.240 N Nufip2 n/a
6 TRCN0000241121 TATGGTGAAATAAACGGTAAT pLKO_005 1320 5UTR 100% 10.800 7.560 N Nufip2 n/a
7 TRCN0000191901 GCTCTGATATTAAACCTGGTT pLKO.1 1945 CDS 100% 2.640 1.848 N Nufip2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534063.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03829 pDONR223 100% 71.6% 72% None (many diffs) n/a
2 ccsbBroad304_03829 pLX_304 0% 71.6% 72% V5 (many diffs) n/a
3 TRCN0000480443 TAAGGCACTTAAGTCACGCAAGTC pLX_317 20.7% 71.6% 72% V5 (many diffs) n/a
4 ccsbBroadEn_08741 pDONR223 100% 71.6% 72% None (many diffs) n/a
5 ccsbBroad304_08741 pLX_304 0% 71.6% 72% V5 (many diffs) n/a
6 TRCN0000479286 AACAACTTCGGTCCGCAAACACTG pLX_317 16.7% 71.6% 72% V5 (many diffs) n/a
Download CSV