Transcript: Mouse XM_006534309.3

PREDICTED: Mus musculus phospholipase C, delta 3 (Plcd3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plcd3 (72469)
Length:
3930
CDS:
91..2325

Additional Resources:

NCBI RefSeq record:
XM_006534309.3
NBCI Gene record:
Plcd3 (72469)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534309.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097073 GAGGCTTATATTAGGGCCTTT pLKO.1 1057 CDS 100% 4.050 5.670 N Plcd3 n/a
2 TRCN0000097070 GCGCAGCTTCTAAGCACATAT pLKO.1 260 CDS 100% 13.200 10.560 N Plcd3 n/a
3 TRCN0000053686 GCGGATGAACTCAGCCAACTA pLKO.1 1725 CDS 100% 4.950 3.960 N PLCD3 n/a
4 TRCN0000097072 GCTTCCTCATAAACGGGCAAT pLKO.1 1835 CDS 100% 4.050 3.240 N Plcd3 n/a
5 TRCN0000443284 CTCTGGCAATCCAGGTGTTAA pLKO_005 1937 CDS 100% 13.200 9.240 N Plcd3 n/a
6 TRCN0000444394 GGTTTGTGGTAGAAGATTATG pLKO_005 2153 CDS 100% 13.200 9.240 N Plcd3 n/a
7 TRCN0000097071 CCAGCAGCTTATCCAGACTTA pLKO.1 831 CDS 100% 4.950 3.465 N Plcd3 n/a
8 TRCN0000097069 CGTAACCTTCATCCCTGAGAA pLKO.1 2626 3UTR 100% 4.950 3.465 N Plcd3 n/a
9 TRCN0000443042 AGATTCCCTGGTCAACTTGAG pLKO_005 2566 3UTR 100% 4.050 2.835 N Plcd3 n/a
10 TRCN0000053685 CGTGGACATGAACGACATGTA pLKO.1 600 CDS 100% 0.495 0.347 N PLCD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534309.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09384 pDONR223 100% 81.3% 84% None (many diffs) n/a
2 TRCN0000476382 GCCGCCGGCAGGTACTAGGAGAGC pLX_317 13.3% 81.3% 84% V5 (many diffs) n/a
Download CSV