Transcript: Mouse XM_006534446.3

PREDICTED: Mus musculus KAT8 regulatory NSL complex subunit 1 (Kansl1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kansl1 (76719)
Length:
4809
CDS:
534..3833

Additional Resources:

NCBI RefSeq record:
XM_006534446.3
NBCI Gene record:
Kansl1 (76719)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534446.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241470 CAAACAGATACGTGCTAATAA pLKO_005 1943 CDS 100% 15.000 21.000 N Kansl1 n/a
2 TRCN0000369878 CAAACAGATACGTGCTAATAA pLKO_005 1943 CDS 100% 15.000 21.000 N KANSL1 n/a
3 TRCN0000241469 ATAACGGCAACGCCAATATTC pLKO_005 640 CDS 100% 13.200 18.480 N Kansl1 n/a
4 TRCN0000241468 AGTCTAGACTTCCGCAATAAT pLKO_005 711 CDS 100% 15.000 12.000 N Kansl1 n/a
5 TRCN0000241467 TTGGCTAAGAAATTGACTAAA pLKO_005 1002 CDS 100% 13.200 10.560 N Kansl1 n/a
6 TRCN0000364923 TTGGCTAAGAAATTGACTAAA pLKO_005 1002 CDS 100% 13.200 10.560 N KANSL1 n/a
7 TRCN0000241466 TACAACACACAACTCTATATA pLKO_005 1183 CDS 100% 15.000 10.500 N Kansl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534446.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13512 pDONR223 100% 40.3% 40.9% None (many diffs) n/a
2 ccsbBroad304_13512 pLX_304 0% 40.3% 40.9% V5 (many diffs) n/a
3 TRCN0000481544 GTGAGCGAAACGACCTGGAATTAA pLX_317 34.3% 40.3% 40.9% V5 (many diffs) n/a
Download CSV