Transcript: Mouse XM_006534461.3

PREDICTED: Mus musculus cytoplasmic FMR1 interacting protein 2 (Cyfip2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cyfip2 (76884)
Length:
6443
CDS:
162..3998

Additional Resources:

NCBI RefSeq record:
XM_006534461.3
NBCI Gene record:
Cyfip2 (76884)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534461.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436464 CGAGATCGAAGCCGAGGTAAA pLKO_005 2300 CDS 100% 10.800 15.120 N Cyfip2 n/a
2 TRCN0000242604 TCATGTACCAGGCTAACTTTG pLKO_005 268 CDS 100% 10.800 8.640 N CYFIP2 n/a
3 TRCN0000097704 CGGGAAGGATGAGATCATTAA pLKO.1 3803 CDS 100% 13.200 9.240 N Cyfip2 n/a
4 TRCN0000242601 ACAACGACAGCGCCTACTATG pLKO_005 2245 CDS 100% 10.800 7.560 N CYFIP2 n/a
5 TRCN0000437285 AGTACGTGAAGACGCTCATAG pLKO_005 3073 CDS 100% 10.800 7.560 N Cyfip2 n/a
6 TRCN0000097703 CCAAGAAGAGAATCAACCTTA pLKO.1 1018 CDS 100% 4.950 3.465 N Cyfip2 n/a
7 TRCN0000097702 CCAGGCTAACTTTGACACGAA pLKO.1 275 CDS 100% 2.640 1.848 N Cyfip2 n/a
8 TRCN0000097701 CCTGGATTCTAACGGACCATA pLKO.1 2167 CDS 100% 4.950 2.970 N Cyfip2 n/a
9 TRCN0000097700 GCAGACCTTCAACCTGGAGGA pLKO.1 4011 3UTR 100% 0.720 0.432 N Cyfip2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534461.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07850 pDONR223 100% 77.6% 85.7% None (many diffs) n/a
2 ccsbBroad304_07850 pLX_304 0% 77.6% 85.7% V5 (many diffs) n/a
3 TRCN0000478326 GAACCCGCTGGAAAAGCGTACGGA pLX_317 7.4% 77.6% 85.7% V5 (many diffs) n/a
Download CSV