Transcript: Mouse XM_006534617.3

PREDICTED: Mus musculus predicted gene 7020 (Gm7020), mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm7020 (629959)
Length:
997
CDS:
20..370

Additional Resources:

NCBI RefSeq record:
XM_006534617.3
NBCI Gene record:
Gm7020 (629959)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534617.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183282 GCGTTGTACTTGATCTCTTAA pLKO.1 722 3UTR 100% 13.200 6.600 Y Lin52 n/a
2 TRCN0000183431 CCTGTCATTCTGAAAGGTATT pLKO.1 617 3UTR 100% 10.800 5.400 Y Lin52 n/a
3 TRCN0000178901 CGCTGAATTTGCAGCTTCTTT pLKO.1 136 CDS 100% 5.625 2.813 Y Lin52 n/a
4 TRCN0000115879 TGGAAGCATCTTTGCTAAGTT pLKO.1 60 CDS 100% 5.625 2.813 Y LIN52 n/a
5 TRCN0000286170 TGGAAGCATCTTTGCTAAGTT pLKO_005 60 CDS 100% 5.625 2.813 Y LIN52 n/a
6 TRCN0000184489 GCTAACCTGATGGAGAAGGTA pLKO.1 251 CDS 100% 3.000 1.500 Y Lin52 n/a
7 TRCN0000184488 GTGTCGCTGAATTTGCAGCTT pLKO.1 132 CDS 100% 2.640 1.320 Y Lin52 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534617.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04560 pDONR223 100% 91% 99.1% None (many diffs) n/a
2 ccsbBroad304_04560 pLX_304 0% 91% 99.1% V5 (many diffs) n/a
3 TRCN0000476840 GACACTCATTATGTGTGCCGTCCA pLX_317 98.3% 91% 99.1% V5 (many diffs) n/a
Download CSV