Transcript: Mouse XM_006534821.2

PREDICTED: Mus musculus protein kinase, cGMP-dependent, type II (Prkg2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prkg2 (19092)
Length:
1707
CDS:
117..965

Additional Resources:

NCBI RefSeq record:
XM_006534821.2
NBCI Gene record:
Prkg2 (19092)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534821.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361437 GAACGGGATCAACGACATTAA pLKO_005 773 CDS 100% 13.200 18.480 N Prkg2 n/a
2 TRCN0000022717 CGTGAAGTTGTATCGTACTTT pLKO.1 215 CDS 100% 5.625 7.875 N Prkg2 n/a
3 TRCN0000001511 GACCAAATGATGACCTACAAT pLKO.1 636 CDS 100% 5.625 4.500 N PRKG2 n/a
4 TRCN0000022715 CCCGAGGTCATTCTTAACAAA pLKO.1 531 CDS 100% 5.625 3.938 N Prkg2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534821.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14798 pDONR223 70.9% 33% 12.3% None (many diffs) n/a
2 ccsbBroad304_14798 pLX_304 0% 33% 12.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000474788 GTGGCTATCTTTATGGTCCATATC pLX_317 19.2% 33% 12.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV