Transcript: Mouse XM_006534844.3

PREDICTED: Mus musculus tetratricopeptide repeat domain 28 (Ttc28), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ttc28 (209683)
Length:
9773
CDS:
122..7450

Additional Resources:

NCBI RefSeq record:
XM_006534844.3
NBCI Gene record:
Ttc28 (209683)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534844.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109971 CGAACATTACTTGGGTGATAA pLKO.1 3886 CDS 100% 13.200 18.480 N Ttc28 n/a
2 TRCN0000109973 GAACATTACTTGGGTGATAAT pLKO.1 3887 CDS 100% 13.200 18.480 N Ttc28 n/a
3 TRCN0000109972 CGGCAAATACACAATGGCGTT pLKO.1 2524 CDS 100% 2.160 3.024 N Ttc28 n/a
4 TRCN0000109970 CCACCCACATAGCCACTGATA pLKO.1 7522 3UTR 100% 4.950 3.960 N Ttc28 n/a
5 TRCN0000109974 CAAGAGGAAGTGATCCTGAAA pLKO.1 5810 CDS 100% 4.950 3.465 N Ttc28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534844.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14077 pDONR223 100% 40.5% 42.2% None (many diffs) n/a
2 ccsbBroad304_14077 pLX_304 0% 40.5% 42.2% V5 (many diffs) n/a
3 TRCN0000479319 TGAAGCCACGTGCATCACTTGCCA pLX_317 12.3% 40.5% 42.1% V5 (many diffs) n/a
Download CSV