Transcript: Mouse XM_006534864.1

PREDICTED: Mus musculus YTH domain containing 1 (Ythdc1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ythdc1 (231386)
Length:
3558
CDS:
585..2807

Additional Resources:

NCBI RefSeq record:
XM_006534864.1
NBCI Gene record:
Ythdc1 (231386)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534864.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246499 AGAGGTCGTTATCGAAGATAA pLKO_005 2787 CDS 100% 13.200 18.480 N Ythdc1 n/a
2 TRCN0000246497 TCCATTCAAGACAATTGATTT pLKO_005 811 CDS 100% 13.200 18.480 N Ythdc1 n/a
3 TRCN0000246500 TGATATGAGGGTCGATGATTT pLKO_005 2591 CDS 100% 13.200 18.480 N Ythdc1 n/a
4 TRCN0000243987 TGGATTTGCAGGCGTGAATTA pLKO_005 1962 CDS 100% 13.200 18.480 N YTHDC1 n/a
5 TRCN0000246498 TGGATTTGCAGGCGTGAATTA pLKO_005 1962 CDS 100% 13.200 18.480 N Ythdc1 n/a
6 TRCN0000246501 GTATGATGGTTTGACTATATG pLKO_005 3236 3UTR 100% 13.200 9.240 N Ythdc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534864.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04559 pDONR223 100% 91.2% 95.2% None (many diffs) n/a
2 ccsbBroad304_04559 pLX_304 0% 91.2% 95.2% V5 (many diffs) n/a
3 TRCN0000465965 CTGTAATCCTACAAACCTTTAATC pLX_317 13.3% 91.2% 95.2% V5 (many diffs) n/a
Download CSV