Transcript: Mouse XM_006535192.2

PREDICTED: Mus musculus Sec31 homolog A (S. cerevisiae) (Sec31a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sec31a (69162)
Length:
4338
CDS:
151..3936

Additional Resources:

NCBI RefSeq record:
XM_006535192.2
NBCI Gene record:
Sec31a (69162)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535192.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341215 GGGATATTGACGGTCTAATTA pLKO_005 1847 CDS 100% 15.000 21.000 N Sec31a n/a
2 TRCN0000341268 CTCATCCTAAAGACGACATTT pLKO_005 3622 CDS 100% 13.200 10.560 N Sec31a n/a
3 TRCN0000352480 CTCTTGGGAGAGCGCATTAAA pLKO_005 1762 CDS 100% 15.000 10.500 N Sec31a n/a
4 TRCN0000341267 TCCTGAGGGATTCTGACTAAT pLKO_005 4182 3UTR 100% 13.200 9.240 N Sec31a n/a
5 TRCN0000341209 TTCCAAGACCAGGCATCTATA pLKO_005 3214 CDS 100% 13.200 7.920 N Sec31a n/a
6 TRCN0000150017 CCTATCATCAAAGTCAGTGAT pLKO.1 757 CDS 100% 4.950 3.465 N SEC31B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535192.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11637 pDONR223 100% 35.5% 38% None (many diffs) n/a
2 ccsbBroad304_11637 pLX_304 0% 35.5% 38% V5 (many diffs) n/a
3 TRCN0000470763 CGCATTTGAGGATCCGCAGCACAG pLX_317 27.7% 35.5% 38% V5 (many diffs) n/a
Download CSV