Transcript: Mouse XM_006535240.2

PREDICTED: Mus musculus transmembrane emp24 protein transport domain containing 5 (Tmed5), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmed5 (73130)
Length:
3622
CDS:
203..520

Additional Resources:

NCBI RefSeq record:
XM_006535240.2
NBCI Gene record:
Tmed5 (73130)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535240.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112354 ACCCTCTTTGGACAGTGATTT pLKO.1 289 CDS 100% 13.200 9.240 N Tmed5 n/a
2 TRCN0000304754 GCATCGTTGGAGATCGAATAC pLKO_005 368 CDS 100% 10.800 7.560 N Tmed5 n/a
3 TRCN0000112351 GCCACATACAAACTCTACTTA pLKO.1 530 3UTR 100% 5.625 3.938 N Tmed5 n/a
4 TRCN0000302420 GCCACATACAAACTCTACTTA pLKO_005 530 3UTR 100% 5.625 3.938 N Tmed5 n/a
5 TRCN0000112352 CGAGATCGAAACATACAAGAA pLKO.1 565 3UTR 100% 4.950 3.465 N Tmed5 n/a
6 TRCN0000112350 GCTCCTTTCTAAATTCTCAAA pLKO.1 1788 3UTR 100% 4.950 3.465 N Tmed5 n/a
7 TRCN0000302484 GCTCCTTTCTAAATTCTCAAA pLKO_005 1788 3UTR 100% 4.950 3.465 N Tmed5 n/a
8 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 1202 3UTR 100% 4.950 2.475 Y Gad2 n/a
9 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 1143 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535240.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08192 pDONR223 100% 40.1% 36.7% None (many diffs) n/a
2 ccsbBroad304_08192 pLX_304 0% 40.1% 36.7% V5 (many diffs) n/a
3 TRCN0000465252 ATTATGAATCCCTAAAAGGTGACA pLX_317 35.6% 40.1% 36.7% V5 (many diffs) n/a
4 ccsbBroadEn_15816 pDONR223 0% 40.1% 36.7% None (many diffs) n/a
5 ccsbBroad304_15816 pLX_304 0% 40.1% 36.7% V5 (many diffs) n/a
6 TRCN0000465707 ATTTAAAGGTTACAATCGGCATGT pLX_317 35.6% 40.1% 36.7% V5 (many diffs) n/a
Download CSV