Transcript: Mouse XM_006535439.3

PREDICTED: Mus musculus transient receptor potential cation channel, subfamily C, member 3 (Trpc3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trpc3 (22065)
Length:
2967
CDS:
242..2890

Additional Resources:

NCBI RefSeq record:
XM_006535439.3
NBCI Gene record:
Trpc3 (22065)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535439.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068305 CCACTCAAGGTCTAGGATCAA pLKO.1 1054 CDS 100% 4.950 6.930 N Trpc3 n/a
2 TRCN0000068304 GCTGCCAAACATCACTGTTAT pLKO.1 1666 CDS 100% 13.200 9.240 N Trpc3 n/a
3 TRCN0000422735 TCGTGTCAAACTTGCCATTAA pLKO_005 1348 CDS 100% 13.200 9.240 N Trpc3 n/a
4 TRCN0000414421 GATATCTCCAGCCTTCGTTAT pLKO_005 2771 CDS 100% 10.800 7.560 N Trpc3 n/a
5 TRCN0000068307 GCTATGTTCTTTATGGGATAT pLKO.1 2367 CDS 100% 10.800 7.560 N Trpc3 n/a
6 TRCN0000044029 CCAGCCTTCGTTATGAACTTT pLKO.1 2778 CDS 100% 5.625 3.938 N TRPC3 n/a
7 TRCN0000068306 GCTATTGGATTGCACCTTGTA pLKO.1 1524 CDS 100% 4.950 2.970 N Trpc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535439.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01714 pDONR223 100% 78.7% 86.2% None (many diffs) n/a
2 ccsbBroad304_01714 pLX_304 0% 78.7% 86.2% V5 (many diffs) n/a
3 TRCN0000476794 TATTATCTAGGACCGGTGTACCTC pLX_317 16.4% 78.7% 86.2% V5 (many diffs) n/a
Download CSV