Transcript: Mouse XM_006535441.3

PREDICTED: Mus musculus zinc finger matrin type 3 (Zmat3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zmat3 (22401)
Length:
8081
CDS:
517..1389

Additional Resources:

NCBI RefSeq record:
XM_006535441.3
NBCI Gene record:
Zmat3 (22401)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535441.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413821 TGACTAGAGCTACGATTATTT pLKO_005 1668 3UTR 100% 15.000 21.000 N Zmat3 n/a
2 TRCN0000436799 TGGTCCTCCATGCGTACATTC pLKO_005 1452 3UTR 100% 10.800 15.120 N Zmat3 n/a
3 TRCN0000112141 CGGAAAGAAGGGAGTGAATTT pLKO.1 1108 CDS 100% 13.200 10.560 N Zmat3 n/a
4 TRCN0000434554 AGTTCTTACTTCCAATTATAG pLKO_005 1746 3UTR 100% 13.200 9.240 N Zmat3 n/a
5 TRCN0000112142 CATGGCAAGAAACTACGAAAT pLKO.1 796 CDS 100% 10.800 7.560 N Zmat3 n/a
6 TRCN0000112144 CTTTACCTAATCGGCCTTCAA pLKO.1 545 CDS 100% 4.950 3.465 N Zmat3 n/a
7 TRCN0000112140 GCCGAGAGAATGTGAACCTTT pLKO.1 7623 3UTR 100% 4.950 3.465 N Zmat3 n/a
8 TRCN0000112143 CTACAGAGAATGACTACTGTA pLKO.1 947 CDS 100% 0.495 0.347 N Zmat3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535441.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03942 pDONR223 100% 84% 86.5% None (many diffs) n/a
2 ccsbBroad304_03942 pLX_304 0% 84% 86.5% V5 (many diffs) n/a
3 TRCN0000475463 TGTCTTAAGCGGCGACGAGGACAT pLX_317 17.2% 84% 86.5% V5 (many diffs) n/a
Download CSV