Transcript: Mouse XM_006535600.3

PREDICTED: Mus musculus BRO1 domain and CAAX motif containing (Brox), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Brox (71678)
Length:
3324
CDS:
428..1324

Additional Resources:

NCBI RefSeq record:
XM_006535600.3
NBCI Gene record:
Brox (71678)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535600.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197928 GCTTCGCATAATAGGAATAAT pLKO.1 2393 3UTR 100% 15.000 21.000 N Brox n/a
2 TRCN0000297309 GCTTCGCATAATAGGAATAAT pLKO_005 2393 3UTR 100% 15.000 21.000 N Brox n/a
3 TRCN0000216189 CAATCAAGACAGTAGTCAATA pLKO.1 2571 3UTR 100% 13.200 18.480 N Brox n/a
4 TRCN0000200267 CACAGCGTATGCGTATTGCTA pLKO.1 835 CDS 100% 3.000 4.200 N Brox n/a
5 TRCN0000198067 CCTTCACTTGAAGATGTGCTT pLKO.1 811 CDS 100% 2.640 1.848 N Brox n/a
6 TRCN0000279550 CCTTCACTTGAAGATGTGCTT pLKO_005 811 CDS 100% 2.640 1.848 N Brox n/a
7 TRCN0000182827 CGATCTCTCCAAGAAGCAGAA pLKO.1 902 CDS 100% 4.050 2.430 N Brox n/a
8 TRCN0000293156 CGATCTCTCCAAGAAGCAGAA pLKO_005 902 CDS 100% 4.050 2.430 N Brox n/a
9 TRCN0000198201 CCCGCTTCAAAGATTTGCAAT pLKO.1 277 5UTR 100% 4.950 6.930 N Brox n/a
10 TRCN0000293155 CCCGCTTCAAAGATTTGCAAT pLKO_005 277 5UTR 100% 4.950 6.930 N Brox n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535600.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05013 pDONR223 100% 61.6% 66.9% None (many diffs) n/a
2 ccsbBroad304_05013 pLX_304 0% 61.6% 66.9% V5 (many diffs) n/a
3 TRCN0000470606 TCCAAAATTTCTCGGTGCAACGGC pLX_317 31.3% 61.6% 66.9% V5 (many diffs) n/a
Download CSV