Construct: ORF TRCN0000470606
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016389.1_s317c1
- Derived from:
- ccsbBroadEn_05013
- DNA Barcode:
- TCCAAAATTTCTCGGTGCAACGGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- BROX (148362)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470606
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 148362 | BROX | BRO1 domain and CAAX motif ... | NM_144695.4 | 100% | 100% | |
| 2 | human | 148362 | BROX | BRO1 domain and CAAX motif ... | XM_005273065.3 | 100% | 100% | |
| 3 | human | 148362 | BROX | BRO1 domain and CAAX motif ... | XM_011509214.3 | 100% | 100% | |
| 4 | human | 148362 | BROX | BRO1 domain and CAAX motif ... | XM_017000374.2 | 100% | 100% | |
| 5 | human | 148362 | BROX | BRO1 domain and CAAX motif ... | XM_006711173.4 | 96% | 96% | 1_51del |
| 6 | human | 148362 | BROX | BRO1 domain and CAAX motif ... | NM_001288579.1 | 92.2% | 92.2% | 305_306ins96 |
| 7 | human | 148362 | BROX | BRO1 domain and CAAX motif ... | NM_001288580.1 | 92.2% | 92.2% | 305_306ins96 |
| 8 | human | 148362 | BROX | BRO1 domain and CAAX motif ... | XM_011509213.3 | 90% | 90.5% | (many diffs) |
| 9 | human | 148362 | BROX | BRO1 domain and CAAX motif ... | XM_005273069.5 | 86.6% | 86.6% | 0_1ins165 |
| 10 | human | 148362 | BROX | BRO1 domain and CAAX motif ... | XM_017000376.2 | 86.6% | 86.6% | 0_1ins165 |
| 11 | human | 148362 | BROX | BRO1 domain and CAAX motif ... | XM_017000375.2 | 82.6% | 83% | (many diffs) |
| 12 | human | 148362 | BROX | BRO1 domain and CAAX motif ... | NM_001288581.1 | 82.2% | 80.5% | 988_989ins160;1014_1015ins59 |
| 13 | human | 148362 | BROX | BRO1 domain and CAAX motif ... | XM_011509212.3 | 81.6% | 81.6% | 1_159del;464_465ins96 |
| 14 | human | 148362 | BROX | BRO1 domain and CAAX motif ... | XR_001736986.1 | 32.4% | 1_42del;711_712insGATCATACTTTATCCA;1260_3740del | |
| 15 | mouse | 71678 | Brox | BRO1 domain and CAAX motif ... | NM_027861.2 | 85.8% | 91.7% | (many diffs) |
| 16 | mouse | 71678 | Brox | BRO1 domain and CAAX motif ... | XM_006535597.3 | 85.8% | 91.7% | (many diffs) |
| 17 | mouse | 71678 | Brox | BRO1 domain and CAAX motif ... | XM_006535598.3 | 85.8% | 91.7% | (many diffs) |
| 18 | mouse | 71678 | Brox | BRO1 domain and CAAX motif ... | XM_006535599.3 | 73.9% | 79.5% | (many diffs) |
| 19 | mouse | 71678 | Brox | BRO1 domain and CAAX motif ... | XM_006535600.3 | 61.6% | 66.9% | (many diffs) |
| 20 | mouse | 71678 | Brox | BRO1 domain and CAAX motif ... | XR_389720.3 | 30.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1302
- ORF length:
- 1233
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gacccattgg tttcatagga acccattaaa agccacagct cctgtgtctt 121 ttaattacta tggtgtagtc actggccctt ctgcttcaaa aatatgcaat gacttgaggt 181 catccagggc acgactcctt gaactgttca ctgatttgag ctgtaatcca gaaatgatga 241 agaatgcagc agattcatat ttctcacttt tacaaggttt cataaattct ttggatgaat 301 ctacccaaga aagcaagtta cgatatattc aaaatttcaa gtggactgat acattgcaag 361 gacaggttcc aagtgcccag caggatgctg tttttgaatt aatttccatg ggatttaatg 421 tagctttatg gtataccaaa tatgcttcaa gactggctgg aaaagaaaat ataacagaag 481 atgaagcaaa agaagttcat cgaagcctaa agattgcagc tgggattttt aaacatttaa 541 aggaaagtca tctcccaaaa ctcattacac ctgcggaaaa aggaagagat ttagagtcac 601 gactcataga agcatacgtt attcaatgtc aggctgaagc tcaagaagta acaattgctc 661 gagcaattga actaaaacat gctcctggac taattgctgc actggcgtat gaaacagcca 721 atttctatca aaaagctgat catactttat ccagtttgga gcctgcatat tctgccaaat 781 ggagaaaata tcttcacttg aagatgtgtt tctacacagc ttatgcttac tgttaccatg 841 gtgagacttt attggctagt gataaatgcg gtgaagcaat caggtctctc caagaagcag 901 aaaaattgta tgcaaaggCA GAAGCACTGT GTAAAGAATA TGGAGAAACC AAAGGACCTG 961 GACCAACAGT CAAACCTTCA GGACATCTGT TCTTTAGGAA ACTTGGAAAC CTTGTGAAGA 1021 ACACCCTAGA AAAATGTCAG AGAGAAAATG GATTTATTTA CTTTCAAAAA ATTCCAACAG 1081 AAGCCCCACA GCTGGAACTC AAAGCAAATT ATGGTCTCGT AGAGCCTATA CCTTTCGAAT 1141 TTCCTCCTAC AAGTGTTCAG TGGACACCAG AAACATTGGC TGCATTTGAT CTCACCAAAA 1201 GACCCAAGGA TGACAGTACT AAACCCAAAC CAGAAGAAGA AGTGAAACCT GTGAAAGAAC 1261 CAGACATCAA ACCTCAAAAG GACACTGGGT GCTACATCTC CTTGCCAACT TTCTTGTACA 1321 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1381 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1441 AGGACGATCC AAAATTTCTC GGTGCAACGG CACGCGTTAA GTCgacaatc aacctctgga 1501 ttacaaaatt tgtgaaagat t