Transcript: Mouse XM_006537711.2

PREDICTED: Mus musculus solute carrier family 31, member 1 (Slc31a1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc31a1 (20529)
Length:
3622
CDS:
62..652

Additional Resources:

NCBI RefSeq record:
XM_006537711.2
NBCI Gene record:
Slc31a1 (20529)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537711.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043349 GATGCCTATGACCTTCTACTT pLKO.1 205 CDS 100% 4.950 6.930 N SLC31A1 n/a
2 TRCN0000300463 GATGCCTATGACCTTCTACTT pLKO_005 205 CDS 100% 4.950 6.930 N SLC31A1 n/a
3 TRCN0000068465 GTAATCAATACACCTGGAGAA pLKO.1 263 CDS 100% 4.050 5.670 N Slc31a1 n/a
4 TRCN0000068467 CAAGTCAGCATTCGCTACAAT pLKO.1 371 CDS 100% 5.625 3.938 N Slc31a1 n/a
5 TRCN0000068463 CCAGGTAGTCATCAGCTACTT pLKO.1 502 CDS 100% 4.950 3.465 N Slc31a1 n/a
6 TRCN0000068464 CAGCATGATGATGATGCCTAT pLKO.1 193 CDS 100% 4.050 2.835 N Slc31a1 n/a
7 TRCN0000068466 GCACCACCATATGGGTATGTA pLKO.1 94 CDS 100% 0.000 0.000 N Slc31a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537711.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00345 pDONR223 100% 86.8% 88.3% None (many diffs) n/a
2 ccsbBroad304_00345 pLX_304 0% 86.8% 88.3% V5 (many diffs) n/a
3 TRCN0000468035 CAGACTTTCTCATAGATTAGGAAT pLX_317 70.3% 86.8% 88.3% V5 (many diffs) n/a
Download CSV