Transcript: Mouse XM_006537755.3

PREDICTED: Mus musculus MOB kinase activator 3B (Mob3b), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mob3b (214944)
Length:
4857
CDS:
445..1083

Additional Resources:

NCBI RefSeq record:
XM_006537755.3
NBCI Gene record:
Mob3b (214944)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537755.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088785 CATCACTTTGACCGTGTCATT pLKO.1 946 CDS 100% 4.950 6.930 N Mob3b n/a
2 TRCN0000088786 TCATCACTTTGACCGTGTCAT pLKO.1 945 CDS 100% 4.950 3.960 N Mob3b n/a
3 TRCN0000364268 GCAGGATGACCTCAAGTATAA pLKO_005 744 CDS 100% 13.200 9.240 N Mob3b n/a
4 TRCN0000088784 CCAGTACATGAATCTGCTTAT pLKO.1 789 CDS 100% 10.800 7.560 N Mob3b n/a
5 TRCN0000419466 ACAGAGATGAACCTCATAGAC pLKO_005 1024 CDS 100% 4.950 3.465 N MOB3B n/a
6 TRCN0000379370 TGGACTTCTTCAATCGCATTA pLKO_005 638 CDS 100% 10.800 6.480 N Mob3b n/a
7 TRCN0000434590 ACAAACACTTCTATTACTTTG pLKO_005 1001 CDS 100% 10.800 7.560 N MOB3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537755.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08964 pDONR223 100% 88.2% 93.9% None (many diffs) n/a
2 ccsbBroad304_08964 pLX_304 0% 88.2% 93.9% V5 (many diffs) n/a
3 TRCN0000469360 GACTACAACCTCGTCTCCTTTAAC pLX_317 62.2% 88.2% 93.9% V5 (many diffs) n/a
Download CSV