Transcript: Mouse XM_006537835.3

PREDICTED: Mus musculus solute carrier family 25, member 51 (Slc25a51), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc25a51 (230125)
Length:
4491
CDS:
277..1173

Additional Resources:

NCBI RefSeq record:
XM_006537835.3
NBCI Gene record:
Slc25a51 (230125)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537835.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123899 GCCTCGTGTAAGTGGTTAATA pLKO.1 4181 3UTR 100% 15.000 21.000 N Slc25a51 n/a
2 TRCN0000123900 GCTCGAATACAGTCTCAGATT pLKO.1 988 CDS 100% 4.950 6.930 N Slc25a51 n/a
3 TRCN0000123902 CCCAATGTTGACCTCTTCGAA pLKO.1 309 CDS 100% 3.000 4.200 N Slc25a51 n/a
4 TRCN0000060234 GCACTTATGTTTGGTCTGTAT pLKO.1 562 CDS 100% 4.950 3.960 N SLC25A51 n/a
5 TRCN0000133722 GCACTTATGTTTGGTCTGTAT pLKO.1 562 CDS 100% 4.950 3.960 N SLC25A52 n/a
6 TRCN0000123901 CGATAAGTTCACAAACACTTA pLKO.1 732 CDS 100% 0.495 0.396 N Slc25a51 n/a
7 TRCN0000123903 GAAACATTACTTGTGTGGCTA pLKO.1 369 CDS 100% 2.640 1.848 N Slc25a51 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537835.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09328 pDONR223 100% 80.5% 86.5% None (many diffs) n/a
2 ccsbBroad304_09328 pLX_304 0% 80.5% 86.5% V5 (many diffs) n/a
3 TRCN0000470593 TAGGAACGATCGATGTACGAGGCA pLX_317 38.3% 80.5% 86.5% V5 (many diffs) n/a
4 ccsbBroadEn_09645 pDONR223 100% 79.9% 85.2% None (many diffs) n/a
5 ccsbBroad304_09645 pLX_304 0% 79.9% 85.2% V5 (many diffs) n/a
6 TRCN0000466448 TAGTGGCTGCGCGCGAACTGTACT pLX_317 39.4% 79.9% 85.2% V5 (many diffs) n/a
Download CSV