Transcript: Mouse XM_006537836.1

PREDICTED: Mus musculus transmembrane protein with EGF-like and two follistatin-like domains 1 (Tmeff1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmeff1 (230157)
Length:
2524
CDS:
357..1478

Additional Resources:

NCBI RefSeq record:
XM_006537836.1
NBCI Gene record:
Tmeff1 (230157)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537836.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080494 GCGTCGTGTATAAAGCAAGAA pLKO.1 990 CDS 100% 4.950 6.930 N Tmeff1 n/a
2 TRCN0000080495 GCAGTACAGATCGCCATTATA pLKO.1 1347 CDS 100% 15.000 10.500 N Tmeff1 n/a
3 TRCN0000080497 GCCAGTTTCAGTGCCATACAA pLKO.1 628 CDS 100% 5.625 3.938 N Tmeff1 n/a
4 TRCN0000080493 CCACAGCAAATGACAAAGCAT pLKO.1 1807 3UTR 100% 3.000 2.100 N Tmeff1 n/a
5 TRCN0000080496 CCATGTTCTTATCGCAGCCAT pLKO.1 1319 CDS 100% 2.640 1.848 N Tmeff1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537836.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07269 pDONR223 100% 86.4% 93.4% None (many diffs) n/a
2 ccsbBroad304_07269 pLX_304 0% 86.4% 93.4% V5 (many diffs) n/a
3 TRCN0000470709 CTGTCTCGGGACTTGTCAGACGTT pLX_317 39.5% 86.4% 93.4% V5 (many diffs) n/a
Download CSV