Transcript: Mouse XM_006537980.3

PREDICTED: Mus musculus fibronectin type III and SPRY domain containing 1-like (Fsd1l), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fsd1l (319636)
Length:
9044
CDS:
1672..3198

Additional Resources:

NCBI RefSeq record:
XM_006537980.3
NBCI Gene record:
Fsd1l (319636)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537980.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248853 CAACAAGGTCATTAGATATTA pLKO_005 1973 CDS 100% 15.000 21.000 N Fsd1l n/a
2 TRCN0000248849 TGATAGCTTGTACTCTATATT pLKO_005 1824 CDS 100% 15.000 21.000 N Fsd1l n/a
3 TRCN0000248850 TCATTTCAACTCTGGCAAATA pLKO_005 1703 CDS 100% 13.200 10.560 N Fsd1l n/a
4 TRCN0000248852 GAACTTCATTGATACACTAAA pLKO_005 1740 CDS 100% 13.200 9.240 N Fsd1l n/a
5 TRCN0000155866 CCAAGTGCTGTGAGAACACTT pLKO.1 3118 CDS 100% 0.495 0.347 N FSD1L n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6996 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537980.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12756 pDONR223 100% 54.8% 58.1% None (many diffs) n/a
2 ccsbBroad304_12756 pLX_304 0% 54.8% 58.1% V5 (many diffs) n/a
3 TRCN0000468566 TCTATTTTATTCCGACCATGGTTT pLX_317 49.8% 54.8% 58.1% V5 (many diffs) n/a
Download CSV