Transcript: Mouse XM_006537982.1

PREDICTED: Mus musculus fibronectin type III and SPRY domain containing 1-like (Fsd1l), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fsd1l (319636)
Length:
7095
CDS:
98..1249

Additional Resources:

NCBI RefSeq record:
XM_006537982.1
NBCI Gene record:
Fsd1l (319636)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537982.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248853 CAACAAGGTCATTAGATATTA pLKO_005 47 5UTR 100% 15.000 21.000 N Fsd1l n/a
2 TRCN0000155866 CCAAGTGCTGTGAGAACACTT pLKO.1 1169 CDS 100% 0.495 0.347 N FSD1L n/a
3 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5047 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537982.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12756 pDONR223 100% 72.6% 77% None (many diffs) n/a
2 ccsbBroad304_12756 pLX_304 0% 72.6% 77% V5 (many diffs) n/a
3 TRCN0000468566 TCTATTTTATTCCGACCATGGTTT pLX_317 49.8% 72.6% 77% V5 (many diffs) n/a
Download CSV