Transcript: Mouse XM_006538046.4

PREDICTED: Mus musculus TBC1 domain family, member 2 (Tbc1d2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Tbc1d2 (381605)
Length:
4445
CDS:
303..3074

Additional Resources:

NCBI RefSeq record:
XM_006538046.4
NBCI Gene record:
Tbc1d2 (381605)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538046.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248872 TCAGCGAGTACGACGACTATG pLKO_005 1957 CDS 100% 10.800 15.120 N Tbc1d2 n/a
2 TRCN0000192334 CCTAAGAAACTCTGTGGGTAT pLKO.1 429 CDS 100% 4.050 5.670 N Tbc1d2 n/a
3 TRCN0000248868 AGACTCCCAGCCGGGTTATTA pLKO_005 640 CDS 100% 15.000 10.500 N Tbc1d2 n/a
4 TRCN0000437191 AGACTCCCAGCCGGGTTATTA pLKO_005 640 CDS 100% 15.000 10.500 N TBC1D2 n/a
5 TRCN0000248870 AGCATCTGGGCACTGAAATAC pLKO_005 937 CDS 100% 13.200 9.240 N Tbc1d2 n/a
6 TRCN0000248869 CAGGCCTTGGTCACCATTATG pLKO_005 3514 3UTR 100% 13.200 9.240 N Tbc1d2 n/a
7 TRCN0000192113 CCTTCAGAACATCTCCCTAAA pLKO.1 917 CDS 100% 10.800 7.560 N Tbc1d2 n/a
8 TRCN0000248871 GTGGGTATTTAAGTAAGTTTG pLKO_005 442 CDS 100% 10.800 7.560 N Tbc1d2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538046.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12212 pDONR223 100% 42.6% 43.5% None (many diffs) n/a
2 ccsbBroad304_12212 pLX_304 0% 42.6% 43.5% V5 (many diffs) n/a
3 TRCN0000474709 GAATAAACCAGACAGCCCTTCGGC pLX_317 41.2% 42.6% 43.5% V5 (many diffs) n/a
Download CSV