Transcript: Mouse XM_006538097.3

PREDICTED: Mus musculus protein tyrosine phosphatase, non-receptor type 3 (Ptpn3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ptpn3 (545622)
Length:
6391
CDS:
140..2947

Additional Resources:

NCBI RefSeq record:
XM_006538097.3
NBCI Gene record:
Ptpn3 (545622)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538097.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081130 CGTACGCAGTACAATCTCATT pLKO.1 657 CDS 100% 4.950 6.930 N Ptpn3 n/a
2 TRCN0000327637 CGTACGCAGTACAATCTCATT pLKO_005 657 CDS 100% 4.950 6.930 N Ptpn3 n/a
3 TRCN0000081131 CCTAGATCTAATGATCGGGAT pLKO.1 892 CDS 100% 2.160 3.024 N Ptpn3 n/a
4 TRCN0000081132 GCCAGTTCATACCAGATCAAA pLKO.1 726 CDS 100% 5.625 4.500 N Ptpn3 n/a
5 TRCN0000327636 GCCAGTTCATACCAGATCAAA pLKO_005 726 CDS 100% 5.625 4.500 N Ptpn3 n/a
6 TRCN0000347504 GAGGATGAACAGGATCTATTC pLKO_005 3440 3UTR 100% 10.800 7.560 N Ptpn3 n/a
7 TRCN0000081128 CCTTGGGTGAACATACTCAAA pLKO.1 965 CDS 100% 4.950 3.465 N Ptpn3 n/a
8 TRCN0000327554 CCTTGGGTGAACATACTCAAA pLKO_005 965 CDS 100% 4.950 3.465 N Ptpn3 n/a
9 TRCN0000081129 CGAACCTCTGAATTGCCCAAA pLKO.1 251 CDS 100% 4.050 2.835 N Ptpn3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538097.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13935 pDONR223 100% 85% 89.7% None (many diffs) n/a
2 ccsbBroad304_13935 pLX_304 0% 85% 89.7% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000467089 CCAGTTTAGAATTTATGGACCGAA pLX_317 16.7% 85% 89.7% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV