Transcript: Mouse XM_006538194.3

PREDICTED: Mus musculus transmembrane protein 246 (Tmem246), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem246 (67063)
Length:
2098
CDS:
346..1557

Additional Resources:

NCBI RefSeq record:
XM_006538194.3
NBCI Gene record:
Tmem246 (67063)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538194.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125471 CATATTTCTATCTGCGTCATT pLKO.1 491 CDS 100% 4.950 3.960 N Tmem246 n/a
2 TRCN0000125469 GCGAGACTTGAATTAGGATTT pLKO.1 1910 3UTR 100% 10.800 7.560 N Tmem246 n/a
3 TRCN0000125473 CAAACCTACAATCCAGACTAT pLKO.1 943 CDS 100% 4.950 3.465 N Tmem246 n/a
4 TRCN0000125470 GCCCTGTATCTAAAGCTCTAT pLKO.1 1063 CDS 100% 4.950 3.465 N Tmem246 n/a
5 TRCN0000125472 TCATATTTCTATCTGCGTCAT pLKO.1 490 CDS 100% 4.050 2.835 N Tmem246 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538194.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04365 pDONR223 100% 88.1% 98.2% None (many diffs) n/a
2 ccsbBroad304_04365 pLX_304 0% 88.1% 98.2% V5 (many diffs) n/a
3 TRCN0000465885 TCGTTTCTTTTATGTTATAGGCAA pLX_317 31.5% 88.1% 98.2% V5 (many diffs) n/a
Download CSV