Transcript: Mouse XM_006538228.3

PREDICTED: Mus musculus DDB1 and CUL4 associated factor 12 (Dcaf12), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dcaf12 (68970)
Length:
3503
CDS:
406..1749

Additional Resources:

NCBI RefSeq record:
XM_006538228.3
NBCI Gene record:
Dcaf12 (68970)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538228.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000323493 GCGTGGATCAACGATACTATG pLKO_005 958 CDS 100% 10.800 15.120 N Dcaf12 n/a
2 TRCN0000276858 TGTCTATGCAAACAGAGTTTG pLKO_005 1840 3UTR 100% 10.800 15.120 N Dcaf12 n/a
3 TRCN0000374661 GGTACTGCATCACTGATACTA pLKO_005 2245 3UTR 100% 5.625 7.875 N Dcaf12 n/a
4 TRCN0000276859 AGTGGTGTGTGGCACGAAATG pLKO_005 693 CDS 100% 10.800 8.640 N Dcaf12 n/a
5 TRCN0000196116 GCCACATCACAGCCTAGATAA pLKO.1 2554 3UTR 100% 13.200 9.240 N Dcaf12 n/a
6 TRCN0000183878 CCACCCTCAGTTTCCTTGTTT pLKO.1 1792 3UTR 100% 5.625 3.938 N Dcaf12 n/a
7 TRCN0000168680 GCTGGCTGAATCATGATGAAA pLKO.1 1583 CDS 100% 5.625 3.938 N DCAF12 n/a
8 TRCN0000168231 CATGATGAAACCTGGAGGAAT pLKO.1 1594 CDS 100% 4.950 3.465 N DCAF12 n/a
9 TRCN0000195833 CCCTAACAGTCTTGCCATCTA pLKO.1 870 CDS 100% 4.950 3.465 N Dcaf12 n/a
10 TRCN0000276856 CCCTAACAGTCTTGCCATCTA pLKO_005 870 CDS 100% 4.950 3.465 N Dcaf12 n/a
11 TRCN0000178814 CCTTTCCACCAAATTGCCATA pLKO.1 1251 CDS 100% 4.050 2.835 N Dcaf12 n/a
12 TRCN0000276857 CCTTTCCACCAAATTGCCATA pLKO_005 1251 CDS 100% 4.050 2.835 N Dcaf12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538228.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07953 pDONR223 100% 88.9% 94.4% None (many diffs) n/a
2 ccsbBroad304_07953 pLX_304 0% 88.9% 94.4% V5 (many diffs) n/a
3 TRCN0000476003 TTATGAACTCCACTGCAACGATCG pLX_317 23.5% 88.9% 94.4% V5 (many diffs) n/a
Download CSV