Transcript: Mouse XM_006538277.2

PREDICTED: Mus musculus hydroxysteroid dehydrogenase like 2 (Hsdl2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hsdl2 (72479)
Length:
2752
CDS:
434..1807

Additional Resources:

NCBI RefSeq record:
XM_006538277.2
NBCI Gene record:
Hsdl2 (72479)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538277.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366984 TCATCCCTTGTTACCGGATTT pLKO_005 1129 CDS 100% 10.800 15.120 N Hsdl2 n/a
2 TRCN0000366983 TACGTGGTTTCTTGATCTAAA pLKO_005 1579 CDS 100% 13.200 10.560 N Hsdl2 n/a
3 TRCN0000099637 CCTACCTTACATCCAAAGCAT pLKO.1 720 CDS 100% 3.000 2.400 N Hsdl2 n/a
4 TRCN0000376103 GAGTATGGCCACTGATGATTT pLKO_005 1657 CDS 100% 13.200 9.240 N Hsdl2 n/a
5 TRCN0000376838 TCATTGCGGACGCTGCATATT pLKO_005 1002 CDS 100% 13.200 9.240 N Hsdl2 n/a
6 TRCN0000376104 TGAACAATGCCAGTGCTATTA pLKO_005 630 CDS 100% 13.200 9.240 N Hsdl2 n/a
7 TRCN0000376102 CACAAGCTGTCTATCAGTTTG pLKO_005 1536 CDS 100% 10.800 7.560 N Hsdl2 n/a
8 TRCN0000099638 CTGAAGAATTTAGAGGTGAAA pLKO.1 882 CDS 100% 4.950 3.465 N Hsdl2 n/a
9 TRCN0000099635 CCCACTGTCATGTAAGGACAT pLKO.1 1878 3UTR 100% 4.050 2.835 N Hsdl2 n/a
10 TRCN0000099639 GCTGAAGAATTTAGAGGTGAA pLKO.1 881 CDS 100% 4.050 2.835 N Hsdl2 n/a
11 TRCN0000099636 GCAATCAAATTGGAGAAGCTA pLKO.1 1760 CDS 100% 3.000 2.100 N Hsdl2 n/a
12 TRCN0000064933 CCTAGCAATCAAATTGGAGAA pLKO.1 1756 CDS 100% 4.050 2.430 N HSDL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538277.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09166 pDONR223 100% 64.7% 61.9% None (many diffs) n/a
2 ccsbBroad304_09166 pLX_304 0% 64.7% 61.9% V5 (many diffs) n/a
3 TRCN0000474144 ACGATATGGAATGTTGGTTCGGTC pLX_317 55% 64.7% 61.9% V5 (many diffs) n/a
Download CSV