Transcript: Mouse XM_006538506.3

PREDICTED: Mus musculus runt related transcription factor 3 (Runx3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Runx3 (12399)
Length:
3380
CDS:
328..1227

Additional Resources:

NCBI RefSeq record:
XM_006538506.3
NBCI Gene record:
Runx3 (12399)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538506.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084882 CAGGTTCAACGACCTTCGATT pLKO.1 399 CDS 100% 4.950 6.930 N Runx3 n/a
2 TRCN0000084879 GAAGAGTTTCACGCTCACAAT pLKO.1 441 CDS 100% 4.950 6.930 N Runx3 n/a
3 TRCN0000084880 CCGCCAGTTTGACCGCTCCTT pLKO.1 726 CDS 100% 0.000 0.000 N Runx3 n/a
4 TRCN0000084878 CCCAAATCAATGTCCTCTCTA pLKO.1 1400 3UTR 100% 4.950 3.465 N Runx3 n/a
5 TRCN0000084881 GAAGATAGAAGACCAGACCAA pLKO.1 555 CDS 100% 2.640 1.848 N Runx3 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1614 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538506.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00230 pDONR223 100% 62.1% 64.3% None (many diffs) n/a
2 TRCN0000476916 CACTGAACTGGTGGTGTTCGACGC pLX_317 18.9% 62.1% 64.3% V5 (many diffs) n/a
Download CSV