Transcript: Mouse XM_006538743.3

PREDICTED: Mus musculus WD and tetratricopeptide repeats 1 (Wdtc1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wdtc1 (230796)
Length:
3936
CDS:
181..2214

Additional Resources:

NCBI RefSeq record:
XM_006538743.3
NBCI Gene record:
Wdtc1 (230796)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538743.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217134 CTTACAAGCAACGGCCATATA pLKO.1 1073 CDS 100% 13.200 18.480 N Wdtc1 n/a
2 TRCN0000247057 CTTACAAGCAACGGCCATATA pLKO_005 1073 CDS 100% 13.200 18.480 N Wdtc1 n/a
3 TRCN0000247060 TGAGCTTTGAACGGCGATATC pLKO_005 242 CDS 100% 10.800 15.120 N Wdtc1 n/a
4 TRCN0000190515 GCAGTATTATGTCGCAGGTCA pLKO.1 921 CDS 100% 2.640 3.696 N Wdtc1 n/a
5 TRCN0000247058 CTTGGTAATGAAGTGTATTTA pLKO_005 3576 3UTR 100% 15.000 12.000 N Wdtc1 n/a
6 TRCN0000247059 CTCATGCTGGAGACCGCATTT pLKO_005 479 CDS 100% 10.800 8.640 N Wdtc1 n/a
7 TRCN0000247061 TGCAACACCACCACGGATATC pLKO_005 1780 CDS 100% 10.800 8.640 N Wdtc1 n/a
8 TRCN0000139116 CGCCACAAAGACCAAAGAAGT pLKO.1 3026 3UTR 100% 4.950 3.960 N WDTC1 n/a
9 TRCN0000140228 GCTCCTTCTTCATCTGGGAAA pLKO.1 1859 CDS 100% 4.050 2.835 N WDTC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538743.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02715 pDONR223 100% 90.1% 96.8% None (many diffs) n/a
2 ccsbBroad304_02715 pLX_304 0% 90.1% 96.8% V5 (many diffs) n/a
3 TRCN0000476621 CATAGTCCTTATTCTACTGAACCC pLX_317 17.5% 90.1% 96.8% V5 (many diffs) n/a
Download CSV