Transcript: Mouse XM_006538748.3

PREDICTED: Mus musculus absent in melanoma 1-like (Aim1l), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Crybg2 (230806)
Length:
5653
CDS:
81..5558

Additional Resources:

NCBI RefSeq record:
XM_006538748.3
NBCI Gene record:
Crybg2 (230806)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538748.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341172 CAAACAGCGCCGAGCCTATTT pLKO_005 5144 CDS 100% 13.200 18.480 N Crybg2 n/a
2 TRCN0000341173 CTACTAGAAGAGGGCGAATAT pLKO_005 4260 CDS 100% 13.200 18.480 N Crybg2 n/a
3 TRCN0000341174 CCGAGGCTGCTGGATACTATA pLKO_005 3638 CDS 100% 13.200 10.560 N Crybg2 n/a
4 TRCN0000341241 TATCCTAGAGCCCGGAGAATA pLKO_005 3959 CDS 100% 13.200 10.560 N Crybg2 n/a
5 TRCN0000341175 ACTTTCTGGGCGACCACATTT pLKO_005 4666 CDS 100% 13.200 9.240 N Crybg2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538748.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12147 pDONR223 100% 28.7% 29.4% None (many diffs) n/a
2 ccsbBroad304_12147 pLX_304 0% 28.7% 29.4% V5 (many diffs) n/a
3 TRCN0000481400 ACACTTGTGTCTAGTGCGGATGTA pLX_317 21.2% 28.7% 29.4% V5 (many diffs) n/a
Download CSV