Transcript: Mouse XM_006538928.1

PREDICTED: Mus musculus pleckstrin homology domain containing, family G (with RhoGef domain) member 5 (Plekhg5), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plekhg5 (269608)
Length:
4006
CDS:
322..3447

Additional Resources:

NCBI RefSeq record:
XM_006538928.1
NBCI Gene record:
Plekhg5 (269608)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538928.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252698 AGGAGTGCTTCACCTTGAAAT pLKO_005 650 CDS 100% 13.200 18.480 N Plekhg5 n/a
2 TRCN0000267454 AGGCTAGCCTCTTACAATTAC pLKO_005 3041 CDS 100% 13.200 18.480 N Plekhg5 n/a
3 TRCN0000252699 TACGACGGCCATGTCCGATTT pLKO_005 439 CDS 100% 10.800 15.120 N Plekhg5 n/a
4 TRCN0000267436 GAGCTGGGTGGACACTATTTA pLKO_005 2454 CDS 100% 15.000 12.000 N Plekhg5 n/a
5 TRCN0000252700 CATCACCTCATGGCCAATTTG pLKO_005 3681 3UTR 100% 13.200 9.240 N Plekhg5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538928.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12347 pDONR223 100% 74.4% 75.9% None (many diffs) n/a
2 ccsbBroad304_12347 pLX_304 0% 74.4% 75.9% V5 (many diffs) n/a
3 TRCN0000477163 GAGTCTTGACCTGTAGGCAGTGAC pLX_317 12.3% 74.4% 75.9% V5 (many diffs) n/a
Download CSV