Transcript: Mouse XM_006539150.3

PREDICTED: Mus musculus keratinocyte differentiation factor 1 (Kdf1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kdf1 (69073)
Length:
2038
CDS:
424..1617

Additional Resources:

NCBI RefSeq record:
XM_006539150.3
NBCI Gene record:
Kdf1 (69073)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539150.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000266853 CGGGAGATCGACGTGCTTATT pLKO_005 1132 CDS 100% 13.200 18.480 N Kdf1 n/a
2 TRCN0000283343 GGGAGAGGCCATCAGAGTTAT pLKO_005 479 CDS 100% 13.200 9.240 N Kdf1 n/a
3 TRCN0000266852 GCCAGCCAAGACTCATCATTC pLKO_005 1543 CDS 100% 10.800 7.560 N Kdf1 n/a
4 TRCN0000266851 GTACTACTCCTTCCATGAATC pLKO_005 1068 CDS 100% 10.800 7.560 N Kdf1 n/a
5 TRCN0000266854 TCCCATGACACCCTAAGCAAT pLKO_005 1876 3UTR 100% 4.950 3.465 N Kdf1 n/a
6 TRCN0000141928 CAAGAAGCTGACAGAGCTGTT pLKO.1 1155 CDS 100% 4.050 2.430 N KDF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539150.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13119 pDONR223 100% 53.9% 57.5% None (many diffs) n/a
2 ccsbBroad304_13119 pLX_304 0% 53.9% 57.5% V5 (many diffs) n/a
3 TRCN0000475889 AACCGAACTCAGTTATTAGGGGTA pLX_317 42% 53.9% 57.5% V5 (many diffs) n/a
Download CSV