Transcript: Mouse XM_006539162.2

PREDICTED: Mus musculus mRNA turnover 4, ribosome maturation factor (Mrto4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mrto4 (69902)
Length:
1027
CDS:
243..821

Additional Resources:

NCBI RefSeq record:
XM_006539162.2
NBCI Gene record:
Mrto4 (69902)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539162.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072700 AGCCGGATGTTCTTTGGCAAA pLKO.1 288 CDS 100% 4.050 5.670 N MRTO4 n/a
2 TRCN0000313421 TCGAAGCCCATCTGATGAATA pLKO_005 335 CDS 100% 13.200 9.240 N Mrto4 n/a
3 TRCN0000313420 TGAGTGGTTCACCAAGTATAC pLKO_005 440 CDS 100% 10.800 7.560 N Mrto4 n/a
4 TRCN0000104355 TCCAGCGAGTTCTTCATCTTT pLKO.1 846 3UTR 100% 5.625 3.938 N Mrto4 n/a
5 TRCN0000349444 TCCAGCGAGTTCTTCATCTTT pLKO_005 846 3UTR 100% 5.625 3.938 N Mrto4 n/a
6 TRCN0000104357 CCAAGTATACAGAAATGGATT pLKO.1 451 CDS 100% 4.950 3.465 N Mrto4 n/a
7 TRCN0000072702 TGGGTATGAGATGGCTGAATT pLKO.1 680 CDS 100% 0.000 0.000 N MRTO4 n/a
8 TRCN0000298246 TGGGTATGAGATGGCTGAATT pLKO_005 680 CDS 100% 0.000 0.000 N MRTO4 n/a
9 TRCN0000072699 CTGCCAAGAAAGGCTTGGAAT pLKO.1 123 5UTR 100% 0.495 0.347 N MRTO4 n/a
10 TRCN0000286645 CTGCCAAGAAAGGCTTGGAAT pLKO_005 123 5UTR 100% 0.495 0.347 N MRTO4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539162.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08234 pDONR223 100% 70.2% 73.6% None (many diffs) n/a
2 ccsbBroad304_08234 pLX_304 0% 70.2% 73.6% V5 (many diffs) n/a
3 TRCN0000466401 TCATGCTGCGCCGTGGGACTGTGA pLX_317 30.2% 70.2% 73.6% V5 (many diffs) n/a
Download CSV