Transcript: Mouse XM_006539169.2

PREDICTED: Mus musculus acyl-CoA thioesterase 7 (Acot7), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Acot7 (70025)
Length:
1473
CDS:
227..1192

Additional Resources:

NCBI RefSeq record:
XM_006539169.2
NBCI Gene record:
Acot7 (70025)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539169.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184639 CGCATGACCTTCACAAGCAAT pLKO.1 932 CDS 100% 4.950 3.960 N Acot7 n/a
2 TRCN0000336540 CGCATGACCTTCACAAGCAAT pLKO_005 932 CDS 100% 4.950 3.960 N Acot7 n/a
3 TRCN0000196237 GATGAGAAGAAGCGCTTCGAA pLKO.1 1106 CDS 100% 3.000 2.400 N Acot7 n/a
4 TRCN0000184110 CAATGTTCATGGAGGGACCAT pLKO.1 256 CDS 100% 2.640 2.112 N Acot7 n/a
5 TRCN0000353511 AGTATGCAGTCACTTAGAAAT pLKO_005 1238 3UTR 100% 13.200 9.240 N Acot7 n/a
6 TRCN0000217466 GCAATAAGTCCATGGAGATTG pLKO.1 948 CDS 100% 10.800 7.560 N Acot7 n/a
7 TRCN0000217515 GGACCATTCTGAAGATGATTG pLKO.1 270 CDS 100% 10.800 7.560 N Acot7 n/a
8 TRCN0000184548 GTGCAGAGATCACCTACACTT pLKO.1 423 CDS 100% 4.950 3.465 N Acot7 n/a
9 TRCN0000336472 GTGCAGAGATCACCTACACTT pLKO_005 423 CDS 100% 4.950 3.465 N Acot7 n/a
10 TRCN0000184256 GCTGACCAATAAAGCCACCTT pLKO.1 508 CDS 100% 2.640 1.848 N Acot7 n/a
11 TRCN0000336539 GCTGACCAATAAAGCCACCTT pLKO_005 508 CDS 100% 2.640 1.848 N Acot7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539169.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11623 pDONR223 100% 85.1% 92% None (many diffs) n/a
2 ccsbBroad304_11623 pLX_304 0% 85.1% 92% V5 (many diffs) n/a
3 TRCN0000480330 ACCTCTGGCGGGTTGGATCATTCG pLX_317 42.9% 85.1% 92% V5 (many diffs) n/a
Download CSV