Transcript: Mouse XM_006539460.2

PREDICTED: Mus musculus N-ethylmaleimide sensitive fusion protein attachment protein alpha (Napa), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Napa (108124)
Length:
974
CDS:
222..884

Additional Resources:

NCBI RefSeq record:
XM_006539460.2
NBCI Gene record:
Napa (108124)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539460.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295307 AGGAAGCATGCGAGATCTATG pLKO_005 337 CDS 100% 10.800 8.640 N Napa n/a
2 TRCN0000295239 TGAGAGCAATTGAGATCTATA pLKO_005 535 CDS 100% 13.200 9.240 N Napa n/a
3 TRCN0000111542 CGCTGGCAATGCTTTCAAGAA pLKO.1 482 CDS 100% 4.950 3.465 N Napa n/a
4 TRCN0000111541 GCAGACTACTACAAAGGAGAA pLKO.1 666 CDS 100% 4.050 2.835 N Napa n/a
5 TRCN0000287879 GCAGACTACTACAAAGGAGAA pLKO_005 666 CDS 100% 4.050 2.835 N Napa n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539460.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02014 pDONR223 100% 66.8% 58.6% None (many diffs) n/a
2 ccsbBroad304_02014 pLX_304 0% 66.8% 58.6% V5 (many diffs) n/a
3 TRCN0000472853 CTGTAGACAATTTAGACTTCCTCG pLX_317 46.2% 66.8% 58.6% V5 (many diffs) n/a
Download CSV