Transcript: Mouse XM_006539501.3

PREDICTED: Mus musculus chloride channel, voltage-sensitive 4 (Clcn4), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Clcn4 (12727)
Length:
5087
CDS:
969..3212

Additional Resources:

NCBI RefSeq record:
XM_006539501.3
NBCI Gene record:
Clcn4 (12727)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539501.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069463 CGGGAGCTAATCTTGGCTATA pLKO.1 2883 CDS 100% 10.800 15.120 N Clcn4 n/a
2 TRCN0000069465 CGCTTACATTCTGAATTACTT pLKO.1 1370 CDS 100% 5.625 7.875 N Clcn4 n/a
3 TRCN0000069464 CCCTGAATCCATCATGTTTAA pLKO.1 3188 CDS 100% 13.200 9.240 N Clcn4 n/a
4 TRCN0000069466 AGTTACTACTTTCCCTTGAAA pLKO.1 1776 CDS 100% 5.625 3.938 N Clcn4 n/a
5 TRCN0000069467 CCTTTGGGAAAGAAGGGATTT pLKO.1 2623 CDS 100% 10.800 6.480 N Clcn4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539501.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00321 pDONR223 100% 86.7% 96.8% None (many diffs) n/a
2 ccsbBroad304_00321 pLX_304 0% 86.7% 96.8% V5 (many diffs) n/a
3 TRCN0000466257 AGAATTAAGGAGCTCTCTAGTAAC pLX_317 15.5% 86.7% 96.8% V5 (many diffs) n/a
Download CSV