Transcript: Mouse XM_006539668.2

PREDICTED: Mus musculus Sh3kbp1 binding protein 1 (Shkbp1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Shkbp1 (192192)
Length:
2417
CDS:
700..2232

Additional Resources:

NCBI RefSeq record:
XM_006539668.2
NBCI Gene record:
Shkbp1 (192192)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539668.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194465 GCCAAATGCCAGTCAGCTATT pLKO.1 1659 CDS 100% 10.800 8.640 N Shkbp1 n/a
2 TRCN0000319971 GCCAAATGCCAGTCAGCTATT pLKO_005 1659 CDS 100% 10.800 8.640 N Shkbp1 n/a
3 TRCN0000174761 GAAGTGATTCATCTGAACGTA pLKO.1 114 5UTR 100% 3.000 2.400 N Shkbp1 n/a
4 TRCN0000319969 GAAGTGATTCATCTGAACGTA pLKO_005 114 5UTR 100% 3.000 2.400 N Shkbp1 n/a
5 TRCN0000175762 GCCTTGTTCTTTGTTGGGAAT pLKO.1 991 CDS 100% 4.050 2.835 N Shkbp1 n/a
6 TRCN0000319970 GCCTTGTTCTTTGTTGGGAAT pLKO_005 991 CDS 100% 4.050 2.835 N Shkbp1 n/a
7 TRCN0000193811 CGAATGTTAGATGAGAGAGCA pLKO.1 585 5UTR 100% 2.640 1.848 N Shkbp1 n/a
8 TRCN0000320045 CGAATGTTAGATGAGAGAGCA pLKO_005 585 5UTR 100% 2.640 1.848 N Shkbp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539668.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09350 pDONR223 100% 61.4% 66.3% None (many diffs) n/a
2 ccsbBroad304_09350 pLX_304 0% 61.4% 66.3% V5 (many diffs) n/a
3 TRCN0000479316 AATACTTACCACCTTTATCTGGTA pLX_317 17.7% 61.4% 66.3% V5 (many diffs) n/a
Download CSV